The description of the protein encoded in this ORF: apoptotic protease activating factor
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 586-4302
Remarks:
Current gene models in Gene database for mouse Apaf-1 present 2, alternatively spliced transcripts
(GI:110347464 and GI:110347470). They differ in a region which is optionally spliced out in variant 2. It
appears Coldwell et al. (2000) have used the second splice variant, with the optional intron excised as
they refer in their article to mouse Apaf-1 having 5'-UTR long 585bp (which is the case of GI:3694812) and
which aligns well with the second splice variant GI:110347470. The difference between the original record
GI:3694812 and current model for splice variant 2 is an extension of 5'-UTR by 40 bp at the 5'-extremity.
Below is shown the region with the optional intron (the alignment of 5'-ends of 5'UTRs is in the record with
pRMmAF plasmid annotation IRESiteID:343):
110347464 aactccggtgcaaaggcttggttacacatccggcgctcacacatcctgttgctcgtcatg
3694812 aactccggtgcaaaggcttg----------------------------------------
110347470 aactccggtgcaaaggcttg----------------------------------------
********************
110347464 acaggcatcctggtgctttgcctctagcccatgctccacagcgaggagagagaaaaccct
3694812 ---ggcatcctggtgctttgcctctagcccatgctccacagcgaggagagagaaaaccct
110347470 ---ggcatcctggtgctttgcctctagcccatgctccacagcgaggagagagaaaaccct
*********************************************************