IRESite record type: plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated: linear
The quality of the mRNA/+RNA sequence: hopefully_full-length_mRNA
The mRNA/+RNA description:
Putative spliced in vitro SV40 promoter-derived transcript of pRMmAF plasmid containing mouse version of
putative Apaf-1 IRES except the very last 2 bases of 5'-UTR. However, the 5'-end of the UTR is maybe
incomplete as well (by 39 bp).
The mRNA/+RNA sequence represented in the +DNA notation:
Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence: end-to-end_sequence_reverse_engineered_and_should_match_experiment
The description of the protein encoded in this ORF: Firefly luciferase
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1765-3417
Remarks:
The cloned 5'-UTR is probably not the complete 5'-UTR of Apaf-1. From the note on page 899 in the article that
the UTR is 585 bases long one can gather that GI:3694812 possibly contains the sequence cloned by authors.
Below is shown the 5'-end of mRNAs annotated in GenBank at the moment.
110347464 gtgtggactgggcgggcccagcggtgtttgagtgctccgcggtcctgaggcagagaccag
3694812 ---------------------------------------cgg-cttgaggcagagaccag
110347470 gtgtggactgggcgggcccagcggtgtttgagtgctccgcggtcctgaggcagagaccag
*** * ***************
We suppose that similarly to the case of pRAF the very last two bases 'ca' of the wild-type 5'-UTR was not
cloned to retain position of the putative IRES 'in frame' with the initiator ATG codon ('CC' bases from
cloning NcoI CCATGG site got into the place instead). This would have been clear if a sequence of the primer
used for cloning would have been published.