IRESite record type: plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated: linear
The quality of the mRNA/+RNA sequence: end-to-end_full-length_mRNA
The mRNA/+RNA description:
Bicistronic RNA encoding B2 and NS´proteins as the first and the second cistron, respectively, with fully
active CSFV IRES inserted between them. Putative T7 promoter-derived transcript transcribed either in vitro or
in vivo in BHK-21 cells infected by recombinant vaccinia virus vTF7-3 containing pXLCSFV1-442.NS.
The mRNA/+RNA sequence represented in the +DNA notation:
Credibility of mRNA sequence: end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the promoter used to express this mRNA: T7
Description of the plasmid (facultative for promoter-less plasmid records): pXLCSFV1-442.NS is a derivative of pXL10S. CSFV IRES corresponding to 1-442 bp of viral genomic RNA has been
inserted between the two cistrons using SalI and SnaBI enzymes. The pXLJ0S contains T7 and SP6 promoter sites
and is typically used in in vitro transcription/translation assays. Bicistronic RNA, which contains B2 and NS
cistrons (GI:214094, GI:21693177), is transcribed by T7 polymerase after vector linearization by EcoRI.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?): not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing: not tested
A promoter reported in cDNA corresponding to IRES sequence: not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid: CSFV
The description of the protein encoded in this ORF: Truncated form of influenza NS1 protein which is N-terminally fused with 3 amino acids
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: no
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1761-2516
Remarks:
IRESite notes about verification of plasmid sequence:
The sequence of pXLCSFV1-442.NS (pXLJ0S respectively) was derived from the pXLJCon sequence which has been
experimentally determined by IRESite curators (please see the IRESite entry 329). The sequence of pXLJ0S
differs from pXLJCon in a creation of SnaBI restriction site at position 4202 of plasmid sequence. A mutation
in vector backbone at position 2808 is indicated in pXLCSFV1-442.NS .gb file provided by IRESite. This
mutation has been detected by sequencing of pXLJCon, thus it is not clear if it is present in pXLJ0S series as
well.
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents): 1389-1780
The underlying nucleic acid sequence and structure of the mapped region:
There is no Vienna RNA package installed on the server or some error/warning messages were output. Due to that maybe we cannot prepare 2D structures for display. The error/warning message was:
WARNING: bases 129 and 347 (AA) can't pair!
WARNING: bases 130 and 346 (CU) can't pair!
WARNING: bases 132 and 344 (AA) can't pair!
WARNING: bases 134 and 342 (CC) can't pair!
WARNING: bases 138 and 336 (AA) can't pair!
WARNING: bases 140 and 334 (UC) can't pair!
WARNING: bases 141 and 333 (GA) can't pair!
WARNING: bases 143 and 308 (CA) can't pair!
WARNING: bases 144 and 307 (GG) can't pair!
WARNING: bases 146 and 305 (GA) can't pair!
WARNING: bases 147 and 304 (CU) can't pair!
WARNING: bases 153 and 257 (GA) can't pair!
WARNING: bases 156 and 254 (UC) can't pair!
WARNING: bases 158 and 252 (GA) can't pair!
WARNING: bases 160 and 249 (CC) can't pair!
WARNING: bases 162 and 247 (AG) can't pair!
WARNING: bases 166 and 179 (CC) can't pair!
WARNING: bases 167 and 178 (CA) can't pair!
WARNING: bases 169 and 176 (GG) can't pair!
WARNING: bases 170 and 175 (AA) can't pair!
WARNING: bases 184 and 234 (GA) can't pair!
WARNING: bases 186 and 232 (CC) can't pair!
WARNING: bases 187 and 231 (AA) can't pair!
WARNING: bases 190 and 226 (AC) can't pair!
WARNING: bases 191 and 225 (GA) can't pair!
WARNING: bases 192 and 224 (UU) can't pair!
WARNING: bases 195 and 218 (GA) can't pair!
WARNING: bases 196 and 217 (AG) can't pair!
WARNING: bases 197 and 216 (CC) can't pair!
WARNING: bases 199 and 214 (UC) can't pair!
WARNING: bases 201 and 212 (AA) can't pair!
WARNING: bases 203 and 210 (CC) can't pair!
WARNING: bases 204 and 209 (AC) can't pair!
WARNING: bases 236 and 245 (GA) can't pair!
WARNING: bases 238 and 243 (CC) can't pair!
WARNING: bases 260 and 280 (CU) can't pair!
WARNING: bases 263 and 277 (GG) can't pair!
WARNING: bases 264 and 276 (GA) can't pair!
WARNING: bases 265 and 275 (CU) can't pair!
WARNING: bases 267 and 273 (GG) can't pair!
WARNING: bases 286 and 298 (CU) can't pair!
WARNING: bases 287 and 297 (AA) can't pair!
WARNING: bases 310 and 319 (CU) can't pair!
WARNING: bases 312 and 317 (GG) can't pair!
Rendering structure of CSFV IRES in an artificial transcript 392 nt long with energy of 44.30 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements (see VARNA modified by IRESite). Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.
Remarks:
Secondary structure from Fig. 1 in Kolupaeva et al. 2000. However the structure has been edited to correspond
to the sequence that authors claimed to use and which is used in this IRESite record.
>gb|J04358.2|HCVCGSA
HSP Classical swine fever virus - Alfort/Tuebingen, complete genome
Length=12297
Score = 200 bits (108), Expect = 1e-48
Identities = 118/122 (96%), Gaps = 4/122 (3%)
Strand=Plus/Plus
Fig. 1 8 AGGTTAG--CTTTCTCGTATACGATATTGGATACACT-AATTTCGATTTGGTCTAGGGCA 64
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||
IRESite 8 AGGTTAGCTCTTTCTCGTATACGATATTGGATACACTAAATTTCGATTTGGTCTAGGGCA 67
Fig. 1 65 CCCCCTCCAGCGACGGCCGAAATGGGCTAGCCATGCCCATAGTAGGACTAGCAAACGGAG 124
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
IRESite 68 -CCCCTCCAGCGACGGCCGAAATGGGCTAGCCATGCCCATAGTAGGACTAGCAAACGGAG 126
Fig. 1 125 GG 126
||
IRESite 127 GG 128
3.1.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 49
The temperature (in degrees of Celsia): 37
The enzymatic method used to determine the 2D structure: ribonuclease T1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 100.00
Mg2+ [mM] 2.50
Ca2+ [mM] 0
Cl- [mM] 100.00
Tris [mM] 20.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
reaction supplemented by 2mM DTT, added 0.015 U/microL (in the absence of 40S) or 0.025 U/microL (in its presence) of T1,
incubation 10 min at 37°C in final volume of 40 microL.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 50
The temperature (in degrees of Celsia): 37
The enzymatic method used to determine the 2D structure: ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH 7.50
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 100.00
Mg2+ [mM] 2.50
Ca2+ [mM] 0
Cl- [mM] 100.00
Tris [mM] 20.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
reaction supplemented by 2mM DTT, added 0.0007 U/microL (in the absence of 40S) or 0.00105 U/microL (in its presence) of V1,
incubation 10 min at 37°C in final volume of 40 microL.
3.1.2. Chemicals used to characterize at least partially the 2D structure.
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 22
The temperature (in degrees of Celsia): 30
The chemical reagent used to determine the 2D structure: DMS
Chemical reagent used with its respective buffer:
Version: 0
pH 7.40
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 100.00
Mg2+ [mM] 2.00
Ca2+ [mM] 0
Cl- [mM] 0
Tris [mM] 20.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations:
104 mM acetate, 1mM DTT
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 23
The temperature (in degrees of Celsia): 30
The chemical reagent used to determine the 2D structure: CMCT
Chemical reagent used with its respective buffer:
Version: 0
pH 7.40
Li+ [mM] 0
Na+ [mM] 0
K+ [mM] 100.00
Mg2+ [mM] 2.00
Ca2+ [mM] 0
Cl- [mM] 0
Tris [mM] 20.00
BSA [mM] 0
HEPES [mM] 0
EGTA [mM] 0
EDTA [mM] 0
cacodylate [mM] 0
Other buffer components and their relative concentrations: