IRESite_Id:39 summary record describing characteristics of crTMV

IRESite: The database of experimentally verified IRES structures

The nucleic acid data:

IRESite Id: `39`	Version: `24`
Originaly submitted by: Tomáš Mašek	Submission date: `2005-06-26 00:00:00`
Reviewed by: Martin Pospíšek	Last change: `2009-08-26 13:35:43`

IRESite record type:

natural_transcript

The shape of the nucleic acid molecule translated: `linear`	The quality of the mRNA/+RNA sequence: `end-to-end_full-length_mRNA`
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule: `crTMV`	The genetic origin of this natural mRNA/+RNA: `viral`

The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
32309927

The mRNA/+RNA description:

Crucifer tobamovirus, complete genome.

The mRNA/+RNA sequence represented in the +DNA notation:

gttttagttt tattgcaaca acaacaacaa attacaataa caacaaacaa aatacaaaca acaacaacat ggcacaattt caacaaacaa ttgacatgca 
^1         ^11        ^21        ^31        ^41        ^51        ^61        ^71        ^81        ^91        

aactctccaa gctgccgcgg gaccgaacag cttggtgaat gatttggcat ctcgtcgcgt ttacgacaat gcggttgagg agctgaatgc ccgttctagg 
^101       ^111       ^121       ^131       ^141       ^151       ^161       ^171       ^181       ^191       

cgtccaaagg tccatttctc caaagcagtg tctacggaac agacgctgat tgcaacgaac gcatatccgg agtttgagat ttccttcact catacacagt 
^201       ^211       ^221       ^231       ^241       ^251       ^261       ^271       ^281       ^291       

ctgctgtgca ctccttggcc ggtggctttc gatcgcttga gttggagtat ctcatgatgc aagttccttt cggttctctg acgtacgata tcggtggtaa 
^301       ^311       ^321       ^331       ^341       ^351       ^361       ^371       ^381       ^391       

cttttctgcg caccttttta agggccgcga ctatgtgcac tgctgtatgc ctaatttgga tgtgcgtgac attgctcgcc acgagggaca taaagaagct 
^401       ^411       ^421       ^431       ^441       ^451       ^461       ^471       ^481       ^491       

attcacagtt acgtgaatcg tttgaaaagg cagcaacgtc ctgtacccga ataccagagg gcagctttca acaattacgc tgagaatccg cactttgtcc 
^501       ^511       ^521       ^531       ^541       ^551       ^561       ^571       ^581       ^591       

attgcgacaa accttttcaa cagtgtgaac ttacgacggc gaatggtact gacacctacg ctgtggctct ccttagtatt tacgatattc ctgttgagga 
^601       ^611       ^621       ^631       ^641       ^651       ^661       ^671       ^681       ^691       

gttcggttcg gcgctactca ggaaaaatgt gaaaacttgt ttcgcagcct tccacttcca tgagaatatg cttcttgatt gtgacacagt cacactcgac 
^701       ^711       ^721       ^731       ^741       ^751       ^761       ^771       ^781       ^791       

gaaatcggag ctactttcca gagggctggt gataatctaa gttttttctt tcacaatgag agcactctca attataccca cagttttagt aatataatta 
^801       ^811       ^821       ^831       ^841       ^851       ^861       ^871       ^881       ^891       

agtatgtgtg taaaacgttc tttcctgcta gtcaacggtt tgtgtatcat aaggagtttt tggttaccag agtcaacact tggtactgta agtttacaag 
^901       ^911       ^921       ^931       ^941       ^951       ^961       ^971       ^981       ^991       

agtggatact tttactcttt tccgtggtgt gtatcataat aatgtggact gcgaagagtt ttacaaggct atggatgacg cgtggcatta caagaagacg 
^1001      ^1011      ^1021      ^1031      ^1041      ^1051      ^1061      ^1071      ^1081      ^1091      

ctagcaatgc tcaatgctga gagaaccatc ttcaaggaca atgcagcgct aaatttttgg ttcccgaaag tgagagacat ggtcatcgtc cctctttttg 
^1101      ^1111      ^1121      ^1131      ^1141      ^1151      ^1161      ^1171      ^1181      ^1191      

acgcttctat tacaacaggg aggatgtcta ggagagaggt tatggtgaac aaggatttcg tttacacggt cctcaaccac ataaaaacgt accaagccaa 
^1201      ^1211      ^1221      ^1231      ^1241      ^1251      ^1261      ^1271      ^1281      ^1291      

agctttaact tacgcaaatg tcctgtcctt tgtggagtct attaggtcta gagtcataat taacggtgtc actgccaggt ctgaatggga cacagacaag 
^1301      ^1311      ^1321      ^1331      ^1341      ^1351      ^1361      ^1371      ^1381      ^1391      

gcaattctag gtccattagc gatgacattt ttccttataa caaagttggg tcatgtgcag gatgaaataa tcctgaaaaa gttccagaaa ttcgatagaa 
^1401      ^1411      ^1421      ^1431      ^1441      ^1451      ^1461      ^1471      ^1481      ^1491      

ccaccaatga gctgatttgg acaagtctct gcgatgccct gatgggggtt attccctcgg tcaaggagac acttgtgcgc ggtggtttcg tgaaagtagc 
^1501      ^1511      ^1521      ^1531      ^1541      ^1551      ^1561      ^1571      ^1581      ^1591      

agaacaggct ctagagataa aaattcccga gctgtactgt acctttgccg acagattggt actgcagtac aagaaagcag aggagttcca atcgtgtgat 
^1601      ^1611      ^1621      ^1631      ^1641      ^1651      ^1661      ^1671      ^1681      ^1691      

ctttccaaac ctctagaaga atccgagaag tactataacg cactatccga gctatctgtg ctcgagaatc tcgattcctt cgacttagag gcttttaaga 
^1701      ^1711      ^1721      ^1731      ^1741      ^1751      ^1761      ^1771      ^1781      ^1791      

ctttatgtca gcagaagagt gtggacccgg acatggcagc aaaggtggtt gtggcaatca tgaagtgtga attaacgttg cctttcaaga aacctacaga 
^1801      ^1811      ^1821      ^1831      ^1841      ^1851      ^1861      ^1871      ^1881      ^1891      

agaggaaatc tcggagtcgc ttaaaacagg tgaggggaca agtgcagagc ataaggatgt gttgagctta caaaatgatg ctccgttccc gtgtgtgaaa 
^1901      ^1911      ^1921      ^1931      ^1941      ^1951      ^1961      ^1971      ^1981      ^1991      

aatctagtag agggttccgt gccggcgtat ggaatgtgtc ctaaaggtgg tggtttcgac aagttggatg tggatattgc tgattttcat ctcaagagtg 
^2001      ^2011      ^2021      ^2031      ^2041      ^2051      ^2061      ^2071      ^2081      ^2091      

tagatgcagt gaaaagggga actatgatgt ctgcggtgta cacggggtca attgaagttc gacaaatgaa gaactacatt gactacttaa gtgcgtcgct 
^2101      ^2111      ^2121      ^2131      ^2141      ^2151      ^2161      ^2171      ^2181      ^2191      

gtcagctaca gtctcaaatc tctgtaaggt gcttagagat gttcacggcg ttgacccaga gtcacaagag aaatcgggag tgtgggacgt tagaagagga 
^2201      ^2211      ^2221      ^2231      ^2241      ^2251      ^2261      ^2271      ^2281      ^2291      

cgttggttac ttaaacctaa cgcgaagagt cacgcgtggg gtgtggcgga agatgccaac cacaagttgg ttattgtgtt gctcaactgg gatgatggaa 
^2301      ^2311      ^2321      ^2331      ^2341      ^2351      ^2361      ^2371      ^2381      ^2391      

agccggtgtg tgacgaaaca tggttcaggg tggccgtgtc aagcgattcc ttgatatact cggatatggg aaaactcaag acgcttacga cgtgcagtcc 
^2401      ^2411      ^2421      ^2431      ^2441      ^2451      ^2461      ^2471      ^2481      ^2491      

gaatggtgag ccaccggaac ctaacgccaa agtaattttg gtcgacggtg ttcccggttg tggaaaaacg aaggagatta tcgaaaaggt aaacttctca 
^2501      ^2511      ^2521      ^2531      ^2541      ^2551      ^2561      ^2571      ^2581      ^2591      

gaggacttga ttttagtccc tgggaaggag gcttctaaga tgattatccg aagggctaac catgctggag taataagagc agataaggac aatgtcagta 
^2601      ^2611      ^2621      ^2631      ^2641      ^2651      ^2661      ^2671      ^2681      ^2691      

cggtagattc cttcttgatg catccttcta ggagggtgtt caagaggtta tttatcgatg aaggactgat gctgcacaca ggctgtgtga atttcctatt 
^2701      ^2711      ^2721      ^2731      ^2741      ^2751      ^2761      ^2771      ^2781      ^2791      

gctactgtct caatgtgacg ttgcatacgt gtatggggac acacaacaaa ttccgttcat ttgcagagtc gcgaacttcc cgtatcctgc acattttgca 
^2801      ^2811      ^2821      ^2831      ^2841      ^2851      ^2861      ^2871      ^2881      ^2891      

aaactcgtcg cagatgagaa ggaggttaga agagttacgc tcaggtgccc agctgatgtc acatatttcc ttaacaagaa gtatgacggg gcggtgatgt 
^2901      ^2911      ^2921      ^2931      ^2941      ^2951      ^2961      ^2971      ^2981      ^2991      

gtactagtgc ggtagagaga tccgtaaagg cagaagtggt aagaggaaaa ggtgctttga acccaataac cttaccgttg gagggtaaaa ttttgacctt 
^3001      ^3011      ^3021      ^3031      ^3041      ^3051      ^3061      ^3071      ^3081      ^3091      

tacgcaggct gacaagttcg agttgctgga gaagggttac aaagatgtga acacagtgca cgaggtgcaa ggggagacgt acgagaagac tgctattgtc 
^3101      ^3111      ^3121      ^3131      ^3141      ^3151      ^3161      ^3171      ^3181      ^3191      

cgtttgacat cgactccgtt agagatcata tcgagagcat cacctcatgt tttggtggcg ctgacaagac acactacgcg ttgtaaatat tacaccgtcg 
^3201      ^3211      ^3221      ^3231      ^3241      ^3251      ^3261      ^3271      ^3281      ^3291      

tgttggaccc tatggtgaat gtgatctcag aaatggagaa gttatctaat tttcttctcg acatgtatag agttgaagcg gggatccaat agcaattaca 
^3301      ^3311      ^3321      ^3331      ^3341      ^3351      ^3361      ^3371      ^3381      ^3391      

gatagatgca gtattcaagg gaacgaactt atttgttcag acgcccaagt ctggagactg gcgagacatg caattttaca atgacactct tcttcccggg 
^3401      ^3411      ^3421      ^3431      ^3441      ^3451      ^3461      ^3471      ^3481      ^3491      

aacagtacta ttcttaatga atatgatgct gtcacgatga atttgaggga tatttcctta aacgtcaaag attgcagaat cgacttctcc aaatccgtgc 
^3501      ^3511      ^3521      ^3531      ^3541      ^3551      ^3561      ^3571      ^3581      ^3591      

agcttcctaa ggagcaacct attttcctta agcctaaaat aagaactgcg gcagaaatgc cgaggactgc aggtttgctg gaaaatttgg tagccatgat 
^3601      ^3611      ^3621      ^3631      ^3641      ^3651      ^3661      ^3671      ^3681      ^3691      

caagagaaac atgaacgcgc cggacctgac agggacaatc gacattgagg atactgcatc tcttgtagtt gaaaagtttt gggattcgta cattgataag 
^3701      ^3711      ^3721      ^3731      ^3741      ^3751      ^3761      ^3771      ^3781      ^3791      

gaattcagcg gaacgaatga aatgaccatg acaagggaaa gtttttctag atggctctct aaacaagagt cgtctacggt tggtcagttg gcggacttta 
^3801      ^3811      ^3821      ^3831      ^3841      ^3851      ^3861      ^3871      ^3881      ^3891      

actttgtaga tttgccggcg gtggatgagt acaagcatat gatcaagagt cagccaaagc aaaagttaga cttgagcatt caagatgaat atcctgcatt 
^3901      ^3911      ^3921      ^3931      ^3941      ^3951      ^3961      ^3971      ^3981      ^3991      

gcagacaata gtctaccatt cgaaaaagat caatgcaatt ttcggtccta tgttttcaga actcacgagg atgttactcg aaagaattga ctcttcgaag 
^4001      ^4011      ^4021      ^4031      ^4041      ^4051      ^4061      ^4071      ^4081      ^4091      

tttctgttct acactagaaa gacaccagcg cagatagagg acttcttctc tgacctagac tcaacccagg cgatggaaat tctagaactc gacatttcga 
^4101      ^4111      ^4121      ^4131      ^4141      ^4151      ^4161      ^4171      ^4181      ^4191      

aatatgacaa gtcacagaac gagttccatt gtgcagtaga gtacaagatc tgggaaaagt taggaatcga tgagtggtta gctgaagtat ggaaacaagg 
^4201      ^4211      ^4221      ^4231      ^4241      ^4251      ^4261      ^4271      ^4281      ^4291      

acacagaaaa acgaccttga aagactatac ggccggaatc aaaacatgtc tttggtatca aaggaaaagt ggtgatgtga cgacctttat aggtaacacc 
^4301      ^4311      ^4321      ^4331      ^4341      ^4351      ^4361      ^4371      ^4381      ^4391      

atcatcattg cagcttgtct gagctcaatg atccccatgg acaaagtgat aaaggcagcc ttttgtggag atgacagcct aatttacatt cctaagggtt 
^4401      ^4411      ^4421      ^4431      ^4441      ^4451      ^4461      ^4471      ^4481      ^4491      

tagacttgcc tgatattcag gcgggcgcga acctcatgtg gaactttgag gccaaactct tcaggaagaa gtatggttac ttctgcggtc gttatgttat 
^4501      ^4511      ^4521      ^4531      ^4541      ^4551      ^4561      ^4571      ^4581      ^4591      

tcaccatgat agaggagcca ttgtatatta cgacccgctg aaactgatat ctaagttagg ttgtaaacat attagagacg ttgttcattt ggaagagtta 
^4601      ^4611      ^4621      ^4631      ^4641      ^4651      ^4661      ^4671      ^4681      ^4691      

cgcgagtctt tgtgtgatgt agctagtaac ctaaataatt gtgcgtattt ttcacagtta gatgaggccg ttgccgaggt tcataagacc gcggtaggcg 
^4701      ^4711      ^4721      ^4731      ^4741      ^4751      ^4761      ^4771      ^4781      ^4791      

gttcgtttgc tttttgtagt ataattaaat atttgtcaga taagagattg tttagagatt tgttctttgt ttgataatgt cgatagtttc gtacgaaccc 
^4801      ^4811      ^4821      ^4831      ^4841      ^4851      ^4861      ^4871      ^4881      ^4891      

aaggtaagtg acttccttaa tctttctaag aaggaagaga tcttgccgaa ggctctaacg aggttaaaga ccgtgtctat tagtactaaa gatattatat 
^4901      ^4911      ^4921      ^4931      ^4941      ^4951      ^4961      ^4971      ^4981      ^4991      

ctgttaagga gtctgagact ttgtgtgata tagatttgtt aatcaatgtg ccattagata agtatagata tgtgggtatc ctaggtgctg tttttaccgg 
^5001      ^5011      ^5021      ^5031      ^5041      ^5051      ^5061      ^5071      ^5081      ^5091      

agagtggctt gtgccagact ttgttaaagg tggtgtgacg ataagtgtga tagataagcg tcttgcgaac tctaaggagt gcgtgattgg tacgtacaga 
^5101      ^5111      ^5121      ^5131      ^5141      ^5151      ^5161      ^5171      ^5181      ^5191      

gctgcagcca agagtaagag gttccagttc aaattggttc caaattactt tgtgtccact gtggacgcaa agaggaagcc gtggcaggtt catgttcgta 
^5201      ^5211      ^5221      ^5231      ^5241      ^5251      ^5261      ^5271      ^5281      ^5291      

ttcaagactt gaagatcgag gcaggttggc agccgttagc tctggaagtg gtttcagttg ctatggttac caataacgtt gttatgaagg gtttgaggga 
^5301      ^5311      ^5321      ^5331      ^5341      ^5351      ^5361      ^5371      ^5381      ^5391      

aaaagtcgtc gcaataaatg atccggacgt cgaaggtttc gaaggtgtgg ttgacgaatt cgtcgattcg gttgcagcat ttaaagcggt tgacaacttt 
^5401      ^5411      ^5421      ^5431      ^5441      ^5451      ^5461      ^5471      ^5481      ^5491      

aaaagaagga aaaagaaggt tgaagaaaag ggtgtagtaa gtaagtataa gtacagaccg gagaagtacg ccggtcctga ttcgtttaat ttgaaagaag 
^5501      ^5511      ^5521      ^5531      ^5541      ^5551      ^5561      ^5571      ^5581      ^5591      

aaaATGTCTT ACAACATTAC AAACCCGAAT CAGTACCAGT ATTTCGCAGC GGTGTGGGCA GAGCCCATTC CGATGCTTAA CCAGTGCATA TCGGCATTGT 
^5601      ^5611      ^5621      ^5631      ^5641      ^5651      ^5661      ^5671      ^5681      ^5691      

CACAATCGTA CCAAACACAA GCTGCGAGAG ACACTGTTAG ACAGCAATTC TCAAACTTGT TGAGTGCGGT TGTGGCTCCG AGCCAGCGGT TCCCAGAAAC 
^5701      ^5711      ^5721      ^5731      ^5741      ^5751      ^5761      ^5771      ^5781      ^5791      

AGGGTCCCGG GTGTATGTTA ACTCGGCTGT TATAAAGCCG TTGTACGAGG CTCTTATGAA GTCCTTTGAT ACTAGAAATA GGATCATAGA GACGGAAGAG 
^5801      ^5811      ^5821      ^5831      ^5841      ^5851      ^5861      ^5871      ^5881      ^5891      

GAGTCACGCC CGTCAGCTTC CGAAGTACGT AACGCGACAC AACGTGTTGA TGATGCGACC GTTTCCATTA GAAGTCAAAT TCAGCTGTTG CTGAGCGAGC 
^5901      ^5911      ^5921      ^5931      ^5941      ^5951      ^5961      ^5971      ^5981      ^5991      

TTTCCAGTGG ACATGGTTAT ATGAACAGGG CAGAGTTCGA GGCTTTGGTG CCATGGACTA CTGCTGCTGC TACTTAGgcg tggtgcgcac gatagcgcat 
^6001      ^6011      ^6021      ^6031      ^6041      ^6051      ^6061      ^6071      ^6081      ^6091      

agtgtttttc tctccacttg aatcgaagag atagacttac ggtgtaaatc cgtaggggtg gcgtaaacca aattacgcaa tgttttgggt tccatttaaa 
^6101      ^6111      ^6121      ^6131      ^6141      ^6151      ^6161      ^6171      ^6181      ^6191      

tcgaaacccc ttatttcctg gatcacctgt taacgcacgt ttgacgtgta ttacagtggg aataagtaaa agtgagaggt tcgaatcctc cctaaccccg 
^6201      ^6211      ^6221      ^6231      ^6241      ^6251      ^6261      ^6271      ^6281      ^6291      

ggtaggggcc ca
^6301      ^6311

Credibility of mRNA sequence:

guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail

The organism containing this mRNA with IRES segment in its genome:

Crucifer tobamovirus

A promoter reported in cDNA corresponding to IRES sequence:
not tested The total number of notable open-reading frames (ORFs):
4

Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:

ORF

ORF position:

1

Version: `4`	Last change: `2009-08-26 13:35:43`
Originaly submitted by: Tomáš Mašek	Reviewed by: Martin Pospíšek

The abbreviated name of this ORF/gene:
CtVgp1

The description of the protein encoded in this ORF:
RNA replicase read-through protein, 178 kDa

The translational frameshift (ribosome slippage) involved:
0 The ribosome read-through involved:
yes

The alternative forms of this protein occur by the alternative initiation of translation:

no

The ORF absolute position (the base range includes START and STOP codons or their equivalents):

69-4874

ORF

ORF position:

2

Version: `4`	Last change: `2009-08-26 13:35:43`
Originaly submitted by: Tomáš Mašek	Reviewed by: Martin Pospíšek

The abbreviated name of this ORF/gene:
CtVgp2

The description of the protein encoded in this ORF:
RNA replicase protein, 122kDa

The translational frameshift (ribosome slippage) involved:
0 The ribosome read-through involved:
no

The alternative forms of this protein occur by the alternative initiation of translation:

yes

The ORF absolute position (the base range includes START and STOP codons or their equivalents):

69-3392

ORF

ORF position:

3

Version: `4`	Last change: `2009-08-26 13:35:43`
Originaly submitted by: Tomáš Mašek	Reviewed by: Martin Pospíšek

The abbreviated name of this ORF/gene:
CtVgp3

The description of the protein encoded in this ORF:
movement protein (MP), 30 kDa

The translational frameshift (ribosome slippage) involved:
0 The ribosome read-through involved:
no

The alternative forms of this protein occur by the alternative initiation of translation:

no

The ORF absolute position (the base range includes START and STOP codons or their equivalents):

4877-5680

ORF

ORF position:

4

Version: `4`	Last change: `2009-08-26 13:35:43`
Originaly submitted by: Tomáš Mašek	Reviewed by: Martin Pospíšek

The abbreviated name of this ORF/gene:
CtVgp4

The description of the protein encoded in this ORF:
coat protein (CP), 17 kDa

The translational frameshift (ribosome slippage) involved:
0 The ribosome read-through involved:
no

The alternative forms of this protein occur by the alternative initiation of translation:

no

The ORF absolute position (the base range includes START and STOP codons or their equivalents):

5604-6077

Remarks:

Both replicase proteins (122 and 178 kDa) are translated from genomic crTMV RNA (Z29370). The movement protein
(MP, 30 kDa) and coat protein (CP, 17 kDa) are translated from two, individual subgenomic RNAs (sgRNAs)
(Ivanov et al., 1997). The uncapped sg I2 RNA functionally encoding only MP has 75bp long 5'-UTR whereas the
sg RNA encoding only CP ORF is capped and had only 9bp long 5'-UTR.

Unexpectedly, the CP protein is also translated from full-length genomic crTMV RNA in which MP and CP ORFs
overlap by 25 codons through IRES. This was shown in in vitro assay using wheat germ cell extracs (Figure 1A
in Ivanov et al., 1997).




In the type member TMV UI (IRESiteId:615) the RdRp proteins are 130 and 183 kDa large. MP (30 kDa) and CP
proteins are translated from two, individual subgenomic RNAs (sgRNAs). Dicistronic uncapped I2 sgRNA codes for
MP and CP proteins but only MP is translated (second cistron encoding CP is silent). Monocistronic capped
sgRNA encodes only the coat protein (CP) (Lehto et al., 1990) and had 9bp long 5'-UTR (Guilley et al., 1979). In
contrast to crTMV no IRES was found in TMV UI in a region preceding the CP ORF. The MP and CP ORFs do not overlap
in TMV UI unlike in crTMV. [see also Ivanov et al., 1997, Figure 1A]


The crTMV IRES of coat protein was characterized in vitro using rabbit reticulocyte lysates, Krebs-2 ascite
cell-free extract and wheat germ extract (WGE). At first, the transcripts used in WGE system contained part of
the viral sequence with MP and CP overlapping coding regions and therefore had no intercistronic region
(Figure 1). Experiments placed IRES CP in its natural context into bicistronic vectors: 1st ORF contained
5'-terminal part of neomycin phosphotransferase ORF followed by IRES CP and the CP ORF itself (Figures 4 and
5). Finally, the crTMV IRES was also placed behind the CP ORF in the intercistronic region while before GUS
(Figures 7 and 8). Integrity of some in vitro transcripts used for RRL in vitro translation system was
verified by agarose gel elecrophoresis of 32P-radiolabelled transcripts back-isolated from the RRL mixture
(Figure 8). [Ivanov et al., 1997]


The sequence shown in Fig. 9 (Ivanov et al., 1997) is slightly different compared to the one deposited
in 2003 by Ryabov into GenBank and based on which this IRESite record is built. The region shown in Fig. 9
is however located between bases 5442-5597 of GI:32309927 (last 3 bases is the ATG codon of CP protein).
On a similar note, the schemas in Fig. 2 of the same publication the start positions of ORFs do not
account for START codons, so the ORFs shown are by 3 bases shorter (replace 4877 with 4874 and 5604 with
5595) and for the C-terminus, replace 6074 with 6068.

Several complete genomes are present in GenBank:
GI:18254496 strain wasabi, isolate Shizuoka, 6298 bp, Lee et al.
GI:18146768 strain wasabi, isolate Tochigi, 6297 bp, Lee et al.
GI:18146763 strain wasabi, isolate Shizuoka, 6298 bp, Lee et al.
GI:32309927, 6304 bp, Ryabov et al. (2003)
GI:488713, 6312bp, Dorokhov et al. (1994) <----- used for this IRESite record
patent GI:33005674, 227 bp, Ryabov et al. (Sequence 1 from patent US 6376745)
patent GI:33005675, 79 bp, Ryabov et al. (Sequence 2 from patent US 6376745)


We cannot find the GC-rich TBS sequence (98bp long 5'-UTR preceding the CP ORF) shown in Figure 2G (Ivanov et
al., 1997) neither in the crTMV RNA under accession number Z29370 nor in GenBank nonred-nt database (which is
worry-some). The crTMV IRES sequence with predicted secondary structure is shown in Figure 6. of the same
article and matches the Z29370 record sequence.

Based on the raw sequencing data of intercistronic regions of hCP-H-GUS, hGFP-H-GUS, GFP-H-GUS, one can
confirm a single-point mutation in the 5'-UTR sequence of sgI2 RNA (-3 to -75 relative to AUG codon of MP
of crTMV) which is present in all these single-sequencing reads. Probably the Z29370 crTMV genomic sequence
contains a mistake (isolated and sequenced by the same scientific group):

Z29370   ttcgtttgctttttgtagtataattaaatatttgtcagataagagattgtttagagatttgttctttgtttgataATGTCGATAGTTTCG
plasmids   cgtttgctttttgtagtataattaaatatttgtcagataagagattggttagagatttgttctttgtttga
                                                          ^

Citations:

Ivanov P. A., Karpova O. V., Skulachev M. V., Tomashevskaya O. L., Rodionova N. P., Dorokhov YuL, Atabekov J. G. (1997) A tobamovirus genome that contains an internal ribosome entry site functional in vitro. Virology. 232(1):32-43

Dorokhov YuL, Ivanov PA, Novikov VK, Agranovsky AA, Morozov SYu, Efimov VA, Casper R, Atabekov JG (1994) Complete nucleotide sequence and genome organization of a tobamovirus infecting cruciferae plants. FEBS Lett. 1(350):5-8

Guilley H, Jonard G, Kukla B, Richards KE (1979) Sequence of 1000 nucleotides at the 3' end of tobacco mosaic virus RNA. Nucleic Acids Res. 4(6):1287-1308

Lehto K, Grantham GL, Dawson WO (1990) Insertion of sequences containing the coat protein subgenomic RNA promoter and leader in front of the tobacco mosaic virus 30K ORF delays its expression and causes defective cell-to-cell movement. Virology. 1(174):145-157

IRESs:

IRES:

Version: `17`	Last change: `2009-08-26 13:35:43`
Originaly submitted by: Tomáš Mašek	Reviewed by: Martin Pospíšek
The IRES name: `crTMV_IREScp`

The IRES absolute position (the range includes START and STOP codons or their equivalents):

5456-5601

Conclusion:
strongly_supported_IRES

How IRES boundaries were determined:
experimentally_determined

5'-end of IRES relative to last base of the STOP codon of the upstream ORF: `582`	3'-end of IRES relative to last base of the STOP codon of the upstream ORF: `727`
5'-end of IRES relative to first base of the START codon of the downstream ORF: `-148`	3'-end of IRES relative to first base of the START codon of the downstream ORF: `-3`

The sequence of IRES region aligned to its secondary structure (if available):

gaattcgtcg attcggttgc agcatttaaa gcggttgaca actttaaaag aaggaaaaag aaggttgaag aaaagggtgt agtaagtaag tataagtaca 
^5456      ^5466      ^5476      ^5486      ^5496      ^5506      ^5516      ^5526      ^5536      ^5546      

gaccggagaa gtacgccggt cctgattcgt ttaatttgaa agaaga
^5556      ^5566      ^5576      ^5586      ^5596

Remarks:

In vitro translation of uncapped TBSMPCP plasmid transcripts which contained presumed TBS stem loop in front
of the first cistron with MP protein revealed that only the protein from second citron (CP protein) was
produced (Figure 3A in Ivanov et al., 1997).

Here is annotated as the IRES region a stretch of 148 bp immediately preceding the ATG codon of CP protein
(see also Figure 6 in the article). Deletion of either 5'- terminal 113 nt or 3'-terminal 35 nt of this IRES
sequence abrogates IRES activity in vitro (Fig. 5). The results suggest functionality of CrTMV IRES in vitro.
The 148 bp region has a good consensus in crucifer-infecting Tobamoviruses (crTMV, TVCV, TMV-Cg lines in
Figure 9) while differs in the other Tobamoviruses. The 148 bp long sequence in type member TMV UI virus lacks
the observed IRES activity of crTMV strain (Fig. 9, TMV UI shown as "TMV").

It is not known from results of Ivanov what is the ratio between IRES mediated translation of CP from genomic
RNA and translation from capped CP sgRNA in vivo. It was observed in vitro that efficiency of translation of
CP protein from monocistronic constructs was higher than that from bicistronic TBSMPCP transcript where
ribosomal movement is impaired by the secondary structure of TBS GC-rich loop.

Results of Toth et al. (2001) in plant protoplasts using PVX-based expression vector show that the IRES-driven
translation is about 24x weaker (Table 2). Interestingly, they also showed that the IRES is functional also in
reverse orientation and that placement of a stable hairpin dowsntream of the IRES blocks translation of the
downstream cistron and that placement of the hairpin upstream of the IRES halved translation of the downstream
cistron.

Skulachev et al. (1999) studied this IRES (148bp long) of the coat protein in the context of yet another
putative IRES in front of the movement protein ORF (228bp long). In vivo tests involved tobacco protoplasts
expressing the bicistronic transcripts using the 35S promoter. In comparison with monocistronic transcripts
both IREScp and IRESmp were about 20-70x weaker in protoplasts. In vitro RRL and WGE were used with constructs
utilizing CP and MP reporters but also CP followed by GUS, GFP by obelin and luc by GUS.

Citations:

Toth RL, Chapman S, Carr F, Santa Cruz S (2001) A novel strategy for the expression of foreign genes from plant virus vectors. FEBS Lett. 2(489):215-219

Skulachev MV, Ivanov PA, Karpova OV, Korpela T, Rodionova NP, Dorokhov YL, Atabekov JG (1999) Internal initiation of translation directed by the 5'-untranslated region of the tobamovirus subgenomic RNA I(2). Virology. 1(263):139-154

IRES:

Version: `3`	Last change: `2009-08-26 13:35:43`
Originaly submitted by: Martin Mokrejš	Reviewed by: Martin Mokrejš
The IRES name: `crTMV_IRESmp75`

The IRES absolute position (the range includes START and STOP codons or their equivalents):

4802-4876

Conclusion:
putative_IRES

How IRES boundaries were determined:
experimentally_determined

5'-end of IRES relative to last base of the STOP codon of the upstream ORF: `1410`	3'-end of IRES relative to last base of the STOP codon of the upstream ORF: `1484`
5'-end of IRES relative to first base of the START codon of the downstream ORF: `-75`	3'-end of IRES relative to first base of the START codon of the downstream ORF: `-1`

The sequence of IRES region aligned to its secondary structure (if available):

ttcgtttgct ttttgtagta taattaaata tttgtcagat aagagattgt ttagagattt gttctttgtt tgata
^4802      ^4812      ^4822      ^4832      ^4842      ^4852      ^4862      ^4872

Remarks:

Dorokhov et al. (2002) studied both crTMV IRESs also in transgenic tobacco plants, in HeLa cells and some
yeast strain where he scaled the IRESs to the EMCV-R IRES.

Citations:

Dorokhov YL, Skulachev MV, Ivanov PA, Zvereva SD, Tjulkina LG, Merits A, Gleba YY, Hohn T, Atabekov JG (2002) Polypurine (A)-rich sequences promote cross-kingdom conservation of internal ribosome entry. Proc. Natl. Acad. Sci. U.S.A. 8(99):5301-5306

IRES:

Version: `3`	Last change: `2009-08-26 13:35:43`
Originaly submitted by: Martin Mokrejš	Reviewed by: Martin Mokrejš
The IRES name: `crTMV_IRESmp228`

The IRES absolute position (the range includes START and STOP codons or their equivalents):

4649-4876

Conclusion:
putative_IRES

How IRES boundaries were determined:
experimentally_determined

5'-end of IRES relative to last base of the STOP codon of the upstream ORF: `1257`	3'-end of IRES relative to last base of the STOP codon of the upstream ORF: `1484`
5'-end of IRES relative to first base of the START codon of the downstream ORF: `-228`	3'-end of IRES relative to first base of the START codon of the downstream ORF: `-1`

The sequence of IRES region aligned to its secondary structure (if available):

atctaagtta ggttgtaaac atattagaga cgttgttcat ttggaagagt tacgcgagtc tttgtgtgat gtagctagta acctaaataa ttgtgcgtat 
^4649      ^4659      ^4669      ^4679      ^4689      ^4699      ^4709      ^4719      ^4729      ^4739      

ttttcacagt tagatgaggc cgttgccgag gttcataaga ccgcggtagg cggttcgttt gctttttgta gtataattaa atatttgtca gataagagat 
^4749      ^4759      ^4769      ^4779      ^4789      ^4799      ^4809      ^4819      ^4829      ^4839      

tgtttagaga tttgttcttt gtttgata
^4849      ^4859      ^4869

Remarks:

The MP IRES can be shortened from 228bp to just 75bp. Surprisingly also in the Tobamovirus type member TMV UI
genome was revealed equivalent to this one in front of MP gene (same 228bp-sized region tested).

Citations:

Last change to the database: 2019-03-18 09:32:49 GMT+1