IRESite record type: plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated: linear
The quality of the mRNA/+RNA sequence: hopefully_full-length_mRNA
The mRNA/+RNA description:
In vitro T3 run-off transcript produced from bicistronic plasmid pSL-RML which comprises renilla and firefly
luciferases as the first and the second cistron, respectively and the 5' UTR of human c-myc (nt from -407 to
-2) mRNA transcribed from major P2 promoter. A stable stem-loop structure was inserted just behind the T3
promoter close to the 5' end of the first cistron of a bicistronic mRNA.These mRNAs are lacking a poly(A)
tail.
The mRNA/+RNA sequence represented in the +DNA notation:
Credibility of mRNA sequence: end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the promoter used to express this mRNA: T3
Description of the plasmid (facultative for promoter-less plasmid records): Plasmid containing 5' UTR of human c-myc transcribed from major P2 promoter (nt from -407 to -2) inserted
between renilla and firefly luciferase reporter genes, without the poly(A)tract.
A synthetic DNA fragment (5' CCCGGAGCGCCCAGATCTGGGCGCTCCGGGGTAC 3') was inserted into the bicistronic c-myc
constructs to introduce a stable stemloop structure (deltaG = - 243 kJ/mol) 19 nts downstream from
transcription start site.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?): not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing: not tested
A promoter reported in cDNA corresponding to IRES sequence: not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid: c-myc
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:
Plasmid sequence verified (partially/completely) by IRESite (more details in Remarks): part of the yet unknown plasmid sequence determined by IRESite curators
GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
The total number of notable open-reading frames (ORFs): 2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
The description of the protein encoded in this ORF: firefly luciferase
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1450-3105
Remarks:
The plasmid was used as the control for experiments in article Enhancement of IRES-Mediated Translation of the
c-myc and BiP mRNAs by the Poly(A) Tail Is Independent of Intact eIF4G and PABP (Thoma et al., 2004; PMID:
15383282).