IRESite record type: plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated: linear
The quality of the mRNA/+RNA sequence: hopefully_full-length_mRNA
The mRNA/+RNA description:
In vitro T3 run-off transcript produced from bicistronic plasmid pSL-RML-p(A) which comprises renilla and
firefly luciferases as the first and the second cistron, respectively and the 5' UTR of human c-myc (nt from
-407 to -2) mRNA transcribed from major P2 promoter. A stable stem-loop structure was inserted just behind the
T3 promoter close to the 5' end of the first cistron of a bicistronic mRNA. These mRNAs are bearing a poly(A)
tail.
The mRNA/+RNA sequence represented in the +DNA notation:
Credibility of mRNA sequence: end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the promoter used to express this mRNA: T3
Description of the plasmid (facultative for promoter-less plasmid records): Plasmid containing 5' UTR of human c-myc transcribed from major P2 promoter (nt from -407 to -2) inserted
between renilla and firefly luciferase reporter genes, with the poly(A)tract.
A synthetic DNA fragment (5' CCCGGAGCGCCCAGATCTGGGCGCTCCGGGGTAC 3') was inserted into the bicistronic c-myc
constructs to introduce a stable stemloop structure (deltaG = - 243 kJ/mol) 19 nts downstream from
transcription start site.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?): not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing: not tested
A promoter reported in cDNA corresponding to IRES sequence: not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid: c-myc
The relative translation efficiency in % of this IRES: 100.000
Name of the plasmid used as the negative control. pSL-RML
IRESite Id of the plasmid used as negative control. 414
The relative translation efficiency in % of the negative control: 0
The size (length) of intercistronic region in the negative control: 423
The effect of 5'-cap analogs on translation: not tested
Rapamycin affects translation: not tested
Type of RNA subject to translation: exogenous_RNA_with_ApppG_cap_with_polyA_tail
Remarks:
The stable stem-loop structure close to the 5' end of the first cistron of a bicistronic mRNA abolishes the
translation of the 5' cistron (RLuc) but has no inhibitory effect on the efficiency of the IRES-mediated
translation of the second cistron (FFLuc).
The IRES-driven translation (of FFLuc) of the non-polyadenylated counterpart of SL-RLuc-c-myc-FFluc-pA RNA (it
means SL-RLuc-c-myc-FFluc RNA; IRESite ID: 414) is non-detectable.
Translational data are derived from Fig. 2B.