Remarks:
Embryonic, larval, and pupal Antp RNA products of 3.5 and 5kb can be detected. Antennapedia is transcribed
from two promoters (P1 and P2) but at least it was not clear in the past whether the protein is produced from
P2 transcript (Laughon et al., (1986)). GI:156946 was not studied by IRESite curator in detail yet.
The transcript from the P1 promoter has 1512nt long 5'-UTR derived from non-coding exons A (55nt), B(88nt),
D(252nt), E (621 out of 777nt are coding) and from coding exons F(39nt), G(226nt), H(819nt; note the
difference to the H exon of P2 variant below). P1 transcripts are of 3.4 and 4.9kb and appear slightly later
than the exon C transcripts (from promoter P2). The 4.9-kb RNA is more abundant than the 3.4-kb species in
embryos. Antp transcripts are also found in third-instar larvae and in pupae at about 1/10 of the embryonic
levels (Laughon et al., (1986) Fig. 2A). [Laughon et al., (1986)]
P1 related GenBank records:
complete P1 mRNA record GI:156948, 4694nt long, CDS[1526-2662]
DNA record GI:156941:
exon A ([3000-3054], 55nt)
DNA record GI:158405:
exon A ([5216-5270], 55nt)
DNA record GI:156942:
exon B ([625-712], 88nt)
DNA record GI:156944:
exon D ([15-266], 252nt),
exon E ([419-1195], 777nt; CDS[575-1195], 621nt),
exon F ([1575-1613], 39nt),
exon G ([1747-1972], 226nt)
DNA record GI:156945:
exon H ([316-1382], 1067nt; CDS[316-566], 251nt; 3'-UTR 817nt)
The P2 transcript (GI:45553280) has 1727-nt long 5'-UTR derived from non-coding exons C (1321nt), D (252nt),
E(621 out of 777nt are coding) and from coding exons exons F(39nt), G(226nt), H(729nt; note the H exon differs
from the P1 variant above). P2 transcripts are 3.6 and 5.1kb; exon C-specific transcripts are first apparent
in 0 to 4h staged embryos, the 3.6-kb RNA is more abundant than the 5.1-kb species at 4 to 8 h (Laughon et
al., (1986) Fig. 2A). [Laughon et al., (1986)]
P2 related GenBank records:
incomplete P2 mRNA record GI:156950, 4419nt long, CDS[1251-2387], 480nt lacking from the very beginning of
5'-UTR from exon C
DNA record GI:156943
exon C ([621-1939], 1319nt); possibly should be 619-1939 to result in exactly same exon sequence as
GI:158406[2532-3852] below to yield 1321nt
DNA record GI:158406
exon C ([2532-3852], 1321nt)
exons D, E, F, G same as P1 transcript
DNA record GI:156945:
exon H ([316-1294], 979nt; CDS[316-566], 251nt; 3'-UTR 729nt)
The exons A, B and C contain a number of "upstream" AUG codons followed by short ORFs which should impair
cap-dependent translation (i.e. both P1 and P2 transcripts). The authentic initiator AUG codon is placed
in exon E shared by both transcripts.
Oh et al. (1992) and later Ye et al. (1997) studied the 5'-UTR of P2 transcript consisting of exons
C(1321nt), D(252nt), E(777nt), F(39nt), G(226nt), H(729nt). The splicing variant J contains whole sequence of
all examined non-coding exons (C, D, E) bearing the putative IRES, matches the 3.4kb size and therefore
IRESite annotation is based on that mRNA sequence.
Antennapedia sequences in RefSeq as of now:
NM_206444.1 transcript variant K, exons C, D, E, G, H
NM_206445.1 transcript variant J, exons C, D, E, F, G, H, 3490nt
NM_206446.1 transcript variant I, exons A, B, D, E, F, G, H
NM_206447.1 transcript variant F, exons C, D, E, G, H
NM_206448.1 transcript variant L, exons C, D, E, F, G, H, 4902nt
NM_206449.1 transcript variant N, exons A, B, D, E, F, G, H
NM_206450.1 transcript variant E, exons A, B, D, E, G, H
NM_206451.1 transcript variant G, exons A, B, D, E, G, H
NM_206452.1 transcript variant D, exons C, D, E, F, G, H, 4890nt
NM_206453.1 transcript variant M, exons A, B, D, E, F, G, H
NM_206454.1 transcript variant H, exons C, D, E, F, G
The three alternatively spliced P2 transcription variants differ except the 3'-end at the
end of exon G, where the NM_206452 has shortened exon G:
NM_206445 atccctggatgcgaagtcagtttggtaagtgtcaagaacgcaaacgcggaaggcagacat
NM_206452 atccctggatgcgaagtcagtttg------------aacgcaaacgcggaaggcagacat
NM_206448 atccctggatgcgaagtcagtttggtaagtgtcaagaacgcaaacgcggaaggcagacat
*********************** *************************
The variants NM_206452 and NM_206448 have otherwise exactly same 3'-ends,
the NM_206445 variant has much shorter 3'-UTR.
Ye et al. (1997) studied functionality of IRES in Drosophila flies and stated: However, the
embryonic central nervous system and larval imaginal tissues, two major sites of Ubx and Antp expression (8,
40), did not exhibit Antp and Ubx IRES activity in our assays despite high levels of dicistronic mRNAs in
these tissues. Further worrisome are the results showing that a minor transcript is produced in flies from
the empty parental dicistronic vector as well as from its derivatives containing 5'-UTR of Ubx (Figure 5). In
summary, at least in some developmental stages IRES presence was NOT proved although mRNA was present which is
explained as a developmentally regulated IRES activity. On the other hand this shows there is either no
cryptic promoter in the putative IRES or at least is tissue specific (Ye et al. (1997), Table 3).
|
natural_transcript