The name of the promoter used to express this mRNA: CMV
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?): yes
The in vivo produced heterogeneous transcripts occur due to alternative splicing: not tested
A promoter reported in cDNA corresponding to IRES sequence: yes
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot: not_tested
Integrity (uniformity) of mRNA tested using RNase protection: not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE: heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using primer extension : not_tested
Integrity (uniformity) of mRNA tested using RT-PCR: not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR): not_tested
Integrity (uniformity) of mRNA tested using RNAi: not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping: not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid: not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter: not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks: not_tested
The description of the protein encoded in this ORF: enhanced green fluorescent protein
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1483-2202
Remarks:
NDST4 is transcribed from two different promoters. The longer NDST4L and shorter NDST4S share only partially
the first exon (432bp vs. 140bp), and completely share the second exon. The upstream promoter is TATA-less.
The downstream promoter includes CAAT/TATA box 77/68 bases upstream the transcription start site and is
located in the first cistron. Total lengths of 5'-UTRs are 669 and 377bp. See Fig. 1 in Grobe and Esko (2002).
The splice sites in all NDST variants are A(G/G)TAAGT...intron...CA(G/N).
A region of the first exon shared by both NDST4L and NDST4S is similar to htrp3 mRNA 5'-UTR region:
>gi|2295902|gb|U47050.1|HSU47050 Homo sapiens calcium influx channel (htrp3) mRNA, complete cds
Length=3417
Score = 119 bits (60), Expect = 3e-24
Identities = 109/124 (87%), Gaps = 1/124 (0%)
Strand=Plus/Plus
Query 28 GAGTGCTCTCAGAATCCTGTTGAGGCAGATGGCACGAACTGAAAGCTCCG-CTAATTAAC 86
Sbjct 4 .........TG....AT.............T...T..............TT......... 63
Query 87 GTGGAGCCAAGTAAACCTGAATTCTGGATATCTCATTTTCTAACTTCGGATAAATTCAAG 146
Sbjct 64 C...........G.........A.............G.......ACG............. 123
Query 147 TTAG 150
Sbjct 124 .... 127