Description of the plasmid (facultative for promoter-less plasmid records): The promoter-less plasmid was created by blunt-end ligation of (deltaSV40)pRSTF plasmid backbone (NotI/NcoI)
with 2 fragments (NheI-PacI and NheI-XbaI) from pRstCVB3F plasmid. The region between PacI and NheI contained
bases 2-46 of CVB3 5'-UTR.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?): no
The in vivo produced heterogeneous transcripts occur due to alternative splicing: no
A promoter reported in cDNA corresponding to IRES sequence: no (not convincing)
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot: not_tested
Integrity (uniformity) of mRNA tested using RNase protection: not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE: not_tested
Integrity (uniformity) of mRNA tested using primer extension : not_tested
Integrity (uniformity) of mRNA tested using RT-PCR: not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR): not_tested
Integrity (uniformity) of mRNA tested using RNAi: not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping: not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid: no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter: not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks: not_tested
The description of the protein encoded in this ORF: Firefly luciferase
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: no
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1843-3495
Remarks:
Jang et al. (2004) constructed this promoter-less plasmid (deltaSV40)pRstCVB3F but for an unknown reason this
plasmid lacks not only SV40 promoter/enhancer region as well as the chimeric intron and T7 promoter region
(the NheI site is just downstream after T7 promoter) but also authors have intentionally omitted also 45bp
long fragment between PacI and NheI sites containing bases 2-46 of CVB3 5'-UTR studied in pRstCVB3F plasmid:
taaaacagcctgtgggttgatcccacccacagggcccattgggcg and performed 3-fragment ligation instead of 2-fragment
ligation.
Jimenez et al. (2005) in Fig. 2C have confirmed the aberrant splicing issue and in Fig. 3C have shown at least
no strong promoter exists in CVB3 IRES using this plasmid.
In summary, it is not the very best plasmid construct to show that CVB3 IRES has no cryptic promoter activity.
Definitely, the pRstCVB3F plasmid contained the 45bp long IRES(promoter?) sequence in contrast to this
promoter-less vector.